albF [2019-03-12 18:55:21]

antilisterial bacteriocin (subtilosin) production

Locus: BSU37420

Isoelectric point: 5.42

Molecular weight: 48.82 kDa

Protein length: 426 aa

Gene length: 1281 bp

Function: antilisterial bacteriocin (subtilosin) production

Product: unknown

Essential: no

Synonyms: ywhN

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Biosynthesis of antibacterial compounds
• Lifestyles → Coping with stress → Biosynthesis of antibacterial compounds
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 3,841,017 → 3,842,297

The protein

Protein family

• peptidase M16 family (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: sboA-sboX-albA-albB-albC-albD-albE-albF-albG
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Rok: repression, PubMed, in Rok regulon
  • ResD: activation, PubMed, in ResD regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • expressed under anaerobic conditions (ResD) PubMed
  • expression of the operon is strongly induced at the beginning of biofilm formation PubMed

Biological materials

Mutant

• MGNA-A526 (ywhN::erm), available at the NBRP B. subtilis, Japan
• BKE37420 (ΔalbF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTCTTCATCCCCTTACT, downstream forward: _UP4_CAATGAAACAAAGCACTGTC
• BKK37420 (ΔalbF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTCTTCATCCCCTTACT, downstream forward: _UP4_CAATGAAACAAAGCACTGTC

References

Loading